Sequence variation and accumulation of repeat copies appeared in the proliferation process. We used the T-test and Mann-Whitney U test with the one-tailed hypothesis to compare the differences of statistics (, SNP density and Tajimas D) between RAR and non-RAR. The genomic data for L. migratoria was downloaded in the Sequence Read Archive (SRA), accession number SRR764584. IEEE International Conference on Big Data 2634-2643 (2019). We believe that low expression of HENMT causes impairment of the piRNA silencing mechanism in the large-genome grasshopper. ), the Talent Fund Project of Jilin Province, the Fundamental Research Funds for the Central Universities (SCU2021D006 and 2020SCUNL103 to T.M.) Our study provides new insights into the mystery of grasshopper genome gigantism. Proc Natl Acad Sci U S A. We believe that LTRs contributed the most to the grasshopper genome size variation. Morris, J. L. et al. (a) Phylogenetic tree of the NF-YB. Other researchers believe that rapid increases in genome size occur mainly through whole-genome duplications (WGD) or bursts in the activity of transposable elements (TEs) [12,13,14]. Fuller, Z. L., Koury, S. A., Phadnis, N. & Schaeffer, S. W. How chromosomal rearrangements shape adaptation and speciation: case studies in Drosophila pseudoobscura and its sibling species Drosophila persimilis. Ogden, P. J., Kelsic, E. D., Sinai, S. & Church, G. M. Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design. In summary, together with the observations that significantly fewer FSGs in the dominant subgenome during B. rapa intraspecific diversification (Fig. Correlation analysis of K2P distance of TE with TE abundance and piRNA abundance. Genome-guided Trinity De novo Transcriptome Assembly. Denver, D. R., Morris, K., Lynch, M. & Thomas, W. K. High mutation rate and predominance of insertions in the Caenorhabditis elegans nuclear genome. Bioinform. Cell Dev. https://www.ncbi.nlm.nih.gov/sra/SRX245287. https://doi.org/10.1371/journal.pone.0036442. 2009;26(6):133340. Genet. The Ping-Pong cycle is a keystone in the piRNA pathway, which allows antisense piRNAs to silence more TE transcripts to generate more sense piRNAs and increase the overall abundance of piRNAs. We first blastX the S. spontaneum gene models in the NCBI NR database of Oryza sativa (see URLs). A., Gennert, D., Schier, A. F. & Regev, A. Spatial reconstruction of single-cell gene expression data. PubMed S2b, c). contributed to the writing. In the tree of life, species with gigantic genomes (larger than 10 GB) only account for a tiny fraction, including lungfishes [4], salamanders [5, 6], deep-sea crustaceans [7, 8], and orthoptera insects [9, 10]. In unanchored sequences, 3,130 gene/alleles were annotated. Cell 174, 13091324.e18 (2018). (b) Comparison of components of intron across the selected plants. Natl Acad. & Guo, F. DeepATT: a hybrid category attention neural network for identifying functional effects of DNA sequences. Nucleic Acids Res. G.G., J. Jpn J Bot. Calle Garca, J. et al. 11, e1117721 (2016). 176, 14101422 (2018). c, Distribution and number of the identified pseudogenes along the hexaploid Sanfensan chromosomes. The first mutations in increasing- and decreasing-expression trajectories either increase or decrease (respectively) the affinity of this site. To reveal the underlying genetic mechanism of sex determination, we carried out genome-wide association studies (GWAS) analysis of sex as a binary phenotype for C. panzhihuaensis and identified the most significant association signals on chromosome 8, spanning the first 124Mb on the reference female genome (Fig. a, Phylogenetic analysis of the TcdA/TcdB pore-forming domain containing proteins shows that the genes encoding four cytotoxin proteins of Cycas were likely acquired from fungi through an ancient horizontal gene transfer event. 4b), revealing that the genes in LF had a significantly lower fractionation rate than those in the MF subgenomes during intraspecific diversification. 3 Correlation between the Sanfensan genome with the hexaploid consensus map and the OT3098 v2 reference genome. S4b, c), evidence that the low expression of HENMT in large-genome grasshoppers impairs the piRNA silencing mechanism. of Chicago Press, 2018). The FUS3/LEC2-like families are unique to gymnosperms, show significant expression after pollination in C. panzhihuaensis (Extended Data Fig. Depending on subgenome location, genes are subjected to subgenome-specific epigenetic regulation [14, 15], altered gene expression and nearby transposon density [16, 17], and frequency of homoeologous chromosome exchange [18, 19]. Acad. One subgenome to rule them all: underlying mechanisms of subgenome dominance. In L. migratoria, both sense and antisense piRNAs of LINE and Ty1_copia elements showed significantly strong correlations with transcript abundance (antisense LINE: r=0.83 p=2.2e05; antisense Ty1: r = 0.8, p=1.1e05; sense LINE r= 0.73 p= 0.00059; sense Ty1: r=0.92, p= 2.5e09; Pearson correlation coefficient), and Ty3_gypsy elements showed relatively weak correlations (antisense: r= 0.31 p= 0.026; sense: r=0.38, p= 0.0058; Pearson correlation coefficient) (Fig. Center for Stem Cell and Regenerative Medicine and Bone Marrow Transplantation Center of the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China, Jiaqi Li,Jingjing Wang,Peijing Zhang,Renying Wang,Yuqing Mei,Zhongyi Sun,Lijiang Fei,Mengmeng Jiang,Lifeng Ma,Weigao E,Haide Chen,Xinru Wang,Yuting Fu,Hanyu Wu,Daiyuan Liu,Xueyi Wang,Jingyu Li,Yuan Liao,Chengxuan Yu,Danmei Jia,Xiaoping Han&Guoji Guo, Liangzhu Laboratory, Zhejiang University Medical Center, Hangzhou, China, Jiaqi Li,Jingjing Wang,Peijing Zhang,Mengmeng Jiang,Haide Chen&Guoji Guo, Zhejiang University-University of Edinburgh Institute, Zhejiang University School of Medicine, Zhejiang University, Hangzhou, China, Zhejiang Provincial Key Laboratory for Tissue Engineering and Regenerative Medicine, Dr. Li Dak Sum & Yip Yio Chin Center for Stem Cell and Regenerative Medicine, Hangzhou, China, Division of Hepatobiliary and Pancreatic Surgery, Department of Surgery, First Affiliated Hospital School of Medicine, Zhejiang University, Hangzhou, China, College of Control Science and Engineering, Zhejiang University, Hangzhou, China, Womens Hospital and Institute of Genetics, Zhenjiang University School of Medicine, Hangzhou, China, Westlake Laboratory of Life Sciences and Biomedicine, Key Laboratory of Growth Regulation and Translational Research of Zhejiang Province, School of Life Sciences, Westlake University, Hangzhou, China, Alibaba-Zhejiang University Joint Research Center of Future Digital Healthcare, Hangzhou, China, You can also search for this author in 25, 955964 (1997). Flynn, J. M. et al. This work was funded in part by the DOE Center for Advanced Bioenergy and Bioproducts Innovation (US DOE, Office of Science, Office of Biological and Environmental Research under Award Number DE-SC 18420 to M.H. For protein evidence, Genewise75 was used to predict gene models based on Cycas proteins downloaded from the UniProt protein database and other proteins collected from representative plant species. Lu J, Clark AG. laboratory for discussions. Generally, if an allele of one SV was enriched in the target morphotype, it indicated that the SV might be related to the target morphotype domestication. Biotechnol. Oat has good adaptability to a wide range of climatic conditions, enabling oat to reliably produce grains in marginal regions with harsh conditions. Nat. Download scientific diagram | Alignment overlap and sequence overlap. More antisense piRNAs can be generated by precise targeting and cleavage of antisense piRNA precursors by sense piRNAs. Midline: median; boxes: interquartile range; whiskers: 5th and 95th percentile range. 5 The phylogeny of LAFL(NF-YB, ABI3, FUS3, and LEC2) transcriptional regulators. Transcripts with FPKM (fragments per kilobase of exon per million fragments mapped)<1 and iso-percentage<3% were removed from further analysis. Kortschak, H. P., Hartt, C. E. & Burr, G. O. Q. We used the RepeatProfiler tool (https://github.com/johnssproul/RepeatProfiler) for visualizing and comparing repetitive DNA profiles of 41 shared TEs from 0.5 coverage short-read sequence data [69],with the following command (repeatprof pre-corr -p data_folder; repeatprof profile -TE.fa data_folder -corr). The consensus sequence of the shared TEs we found exists in both species. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. volume22, Articlenumber:166 (2021) De novo assemblies when necessary were obtained with Trinity for transcriptomes or spades v. 3.14.1 for genomes and single amplified genomes (SAGs). The second group was mainly derived from the insertion of AGK7 or Os7 into AGK4 or Os4, and the remaining five groups were each derived from at least three ancestral chromosomes via complex translocations (Fig. There is a strong correlation between the variants identified by large-scale resequencing accessions and the B. rapa pan-genome. & Mathew, P. M. Cytological studies in the cycads: sex chromosomes in Cycas. Preprint at https://arxiv.org/abs/2010.10614 (2020). Terms and Conditions, Trends Ecol. The abbreviated name given before the protein ID represents species name: CYCAS: Cycas panzhihuaensis, Gb: Ginkgo biloba, SEGI: Sequoiadendron giganteum, GMON: Gnetum montanum, PICABI: Picea abies, PITA: Pinus taeda, ATH, Arabidopsis thaliana, DEBAO: Cycas debaoensis, AMTR: Amborella trichopoda, OS: Oryza sativa. 8), which encodes a GGM13-like MADS-box transcription factor (TF), belonging to a lineage sister to the angiosperm AP3/PI clade that plays crucial roles in floral development. Biotechnol. Sci. G.G. Second, GeneWise (version 2.4.1) [80] with default parameters was used to predict homology-based gene models. Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. For these small RNA-Seq data, the 3-adaptor sequences were removed using the Cutadapt (v3.3) [118] software and trimmed small RNA reads were 1831 nt in length (cutadapt -a AGATCGGAAGAGCACACGTCTGAAC -m 18 -M 31). Zhao Q, Feng Q, Lu HY, Li Y, Wang A, Tian QL, et al. & Matuszewski, S. The utility of fitness landscapes and big data for predicting evolution. 24, 15861591 (2007). DHont, A. et al. SnpEff (v3.6c)88 was used to assign variants effects on the basis of gene models from S. spontaneum genome annotation. Biol. CAS This is a sorghum-specific inversion in SbChr04 (A4), because the orientation of this chromosomal fragment is the same in rice, Miscanthus, and S. spontaneum. On a copy number scale, the giant genome grasshopper species has a higher copy number of repetitive elements. Tiny genomes and endoreduplication in Strepsiptera. Li, J., Wang, J., Zhang, P. et al. 2018;6:256. Composability of regulatory sequences controlling transcription and translation in Escherichia coli. was supported by a Canadian Institutes for Health Research Fellowship and the NIH (K99-HG009920-01); and F.A.C. 2018;52:13157. (b) Expression of CYCAS_034085 on MSY and CYCAS_010388 on chromosome 2 in male microsporophyll and in the ovule. de Visser, J. g Ratio of least, more, and most flexible syntenic genes in the three-copy genes. E.D.V. Top left: Pearsons r and associated two-tailed P values. Thompson, D. A. et al. Sci. GWAS analysis of sex differentiation was performed on the linkage disequilibrium-pruned SNP set using the EMMAX program103 (beta-07Mar2010 version). Extensive gene content variation in the Brachypodium distachyon pan-genome correlates with population structure. and X.X. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. These results validate a hypothesis that piRNA abundance correlates with the transpositional activity of a TE family, with the most recently active TE families being the most abundant among TE-derived piRNAs [30, 98]. Additionally, the genic region (the regions of the gene body and 2-kb flanking sequences) of the FSGs harbored significantly more LTR-RTs than CSGs (P < 2.2e16) (Fig. Of course, the piRNA clusters also showed to be highly dynamic responses to TEs variation [53]. b, The archetypal embeddings learned by the autoencoder accurately capture evolvability vectors. Mapping quantitative trait loci for leaf and heading-related traits in chinese cabbage (Brassica rapa L. ssp pekinesis). Nature 593, 101107 (2021). Mol. analyzed sugar transporters; D.N. (a) Mean saliency scores show transcriptional start site and important information-rich region recognized by Nvwa. Fraser, J. The figure on the right shows the distribution of ratios of fractionated genes to the genes in each bin of the inferred ancestral genome, and the dotted line represents the average of these ratios in each subgenome. 6 and Supplementary Table 17). Curr Opin Plant Biol. In addition, stem and root tissues of C. panzhihuaensis were used to generate full-length transcriptomes (Supplementary Table 2). We thank Xiaoqiang Guo for his help in identifying and dissection of grasshoppers. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres. Grob S, Schmid MW, Grossniklaus U. Hi-C Analysis in Arabidopsis Identifies the KNOT, a Structure with Similarities to the flamenco Locus of Drosophila. Yuan Huang. (b) The bar chart showing the conserved neuron-related TFs between human and other species. Plant Cell. Picelli, S. et al. PubMed Research on germ cells in adult male mice showed that loss of HENMT function and the concomitant loss of piRNAs resulted in TE derepression in adult meiotic and haploid germ cells [65]. Genet. (a) Sketch of the Cycas sperm. 2 Genome assembly quality assessment. and A.R. When we compared the expression of key genes in the piRNA pathway between the two species, we found a differentially expressed gene, HENMT. a-b, Dot plots show the distribution of the genomic fragments from A. longiglumis (a) and A. insularis (b) that were uniquely mapped to the Sanfensan genome. Repeat sequences with more than ten monomers AAACCT were identified as telomeres. Leitch AR, Leitch IJ. However, there are still some issues that need to be resolved. From primary to secondary growth: origin and development of the vascular system. 10 Comparison of alternative spicing (AS) events and TE density in the 12,225 strict 1:1:1 triplets in each subgenome of hexaploid oat. Heterotypic piRNA Ping-Pong requires qin, a protein with both E3 ligase and Tudor domains. Pseudo-chromosomes of 12 accessions with relatively higher contig N50 values were constructed with Hi-C data using the 3D-DNA pipeline (version 180419) [50]. 17, e1008925 (2021). On the basis of the 7,353 one-to-one orthologous gene sets identified among the genome assemblies for Hordeum vulgare, we calculated the nonsynonymous (Ka) and synonymous substitution (Ks) rates for the A-genome (A. atlantica and A. longiglumis) and C-genome (A. eriantha) diploid progenitors of the hexaploid oat, and the subgenomes of A. insularis and Sanfensan. Each subplot shows the in silico mutagenesis effects for how expression level (colour) changes when mutating each position (x axis) to each of the four bases (y axis) of each sequence (subplots) in the trajectories. Li, H. et al. Genome assemblies and annotations of Brassica rapa accessions. DNA Res. 1118; iso-2; iso-3. Raw reads were processed with IsoSeq3 pipeline (https://github.com/PacificBiosciences /IsoSeq) to identify full-length, nonchimeric circular consensus sequences (CCSs). materials for the RNA-Seq workshop on Trinity and Tuxedo, covering de novo and genome-guided transcript assembly and downstream analysis. 2b), as might be predicted for these features. 4 Signatures of stabilizing selection on gene expression detected from regulatory DNA across natural populations. 3b), and genes involved in the biosynthesis of these two phytohormones were also more highly expressed in unpollinated ovules, indicating the higher demand for these hormones as agents of pathogen resistance in the unpollinated ovule. Controlling gene expression with deep generative design of regulatory DNA, https://codeocean.com/capsule/8020974/tree. Deep learning of immune cell differentiation. & Robinson-Rechavi, M. Robust inference of positive selection on regulatory sequences in the human brain. We also identified 1,093,198 heterozygous SNPs and 66,019 heterozygous InDels, giving an overall heterozygosity rate of 0.011%, indicating that the Sanfensan genome is largely homozygous. RNA-seq and Small RNA-seq data of Acrididae species. Avni, R. et al. CAS Nat. and 62088101 to J.C.; National Key Research and Development Program grants 2018YFA0800503 to G.G., 2018YFA0107804 to G.G. p>0.05. Agarwal, V. & Shendure, J. The authors declare that they have no competing interests. 2020;6(8):92941. Kim D, Landmead B, Salzberg SL. Du, X.-Y., Lu, J.-M. & Li, D.-Z. Genome-guided Trinity De novo Transcriptome Assembly. The authors declare that they have no competing interests. C.R., Yuanying Peng, T.M., F.L. Bioinformatics 27, 16531659 (2011). PubMed Central contributed the SP80-3280 genome; and R.M., A.H.P., J.Z., H.T. Comparative analysis of transposable elements highlights mobilome diversity and evolution in vertebrates. e Ratio of FSGs in the three subgenomes of the 18 B. rapa genomes. The ping-pong cycle is a keystone of the piRNA pathway because it both silences TEs post-transcriptionally and enhances the silencing capacity of the pathway by producing more piRNA [95, 96]. Google Scholar. Proc. Nucleic Acids Res. Horticulture Environ Biotechnol. 2012;30(1):105U157. Alfsnes K, Leinaas HP, Hessen DO. 26, 990999 (2016). A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. To test whether the observed abundance patterns of specific TEs were driven by ancient proliferation events or by recent activities, we first generated divergence landscapes for TEs within each genome using dnaPipeTE (see the Methods section). S.Z., H.L., X.G. This work is part of the 10KP project (https://db.cngb.org/10kp/) and was also supported by China National GeneBank (CNGB; https://www.cngb.org/). PubMed J. Nat. Thompson, J. D., Higgins, D. G. & Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Gene structures were visualized in JBrowse68 along with RNA-seq-assembled transcripts and homologs from the sorghum, maize and rice genomes. Bioinformatics 22, 12691271 (2006). r represents the Pearson correlation coefficient, with statistical significance noted as * p<0.05; ** p<0.01; *** p<0.001; N.S. If material is not included in the articles Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. Construction of a human cell landscape at single-cell level. Xu, Z. Biotechnol. Lim SL, Qu ZP, Kortschak RD, Lawrence DM, Geoghegan J, Hempfling A-L, et al. All three types of immune receptorsCC-NBS-LRR (CNL), TIR-NBS-LRR (TNL) and RPW8-NBS-LRR (RNL)show patterns of expansion in C. panzhihuaensis and other gymnosperms, compared with non-seed plants (Supplementary Note 14). Gupta, S., Stamatoyannopoulos, J. Nature 430, 679682 (2004). Recovering gene interactions from single-cell data using data diffusion. Reads of mapped rRNA accounted for 4.90% (L. migratoria testis) and 10.13% (A. rhodopa testis) of clean data, respectively. Czech B, Hannon GJ. Defining alleles in an autopolyploid genome clarifies gene or gene family analysis, as demonstrated in P450 and other gene families. However, the evolution of the dominant subgenome during intraspecific diversification is unexplored. (b) Barplot of the Nvwa and single-cell ATAC cell type specific motifs for mouse. Nat. Thank you for visiting nature.com. Nature. USA 95, 12450 (1998). We sampled three biological replicates for each tissue sample. Abundance of antisense piRNAs corresponding to A. rhodopa retrotransposon transcripts (RPM normalization). Trinity Transcript Quantification. Bi-allelic and polymorphic SNPs (3,969,408) were used for reconstructing the phylogenetic relationships among 64 accessions. (n=9,168, 9,168, 9,168, and 9,171 indepent samples for groups A, B, C, and D, respectively). PubMed Central BMC Bioinform. Bioinformatics 25, 19721973 (2009). & Huckins, L. M. Massively parallel techniques for cataloguing the regulome of the human brain. Impacts of allopolyploidization and structural variation on intraspecific diversification in Brassica rapa. Condamine, F. L., Rolland, J., Hhna, S., Sperling, F. A. Vanneste K, Maere S, Van de Peer Y. 26, 6674 (2010). We thank M20 (Hangzhou), G-BIO (Hangzhou), BGI (Shenzhen) and CNGB (Shenzhen) for supporting the sequencing experiments; and Vazyme (Nanjing) for supplying the customized enzymes used in the study. For example, although the second homoeologous group of oat and wheat are mainly derived from AGK4 or Os4 and AGK7 or Os7, the arrangement patterns of these two ancestral chromosomes are different. Nucleic Acids Res. Commun. The piRNA clusters are transcribed into multiple long precursor transcripts which are then cut and processed into small RNAs that are reverse complementary to TE transcripts [46, 47]. The rest of the DNA was used to generate short-read sequences using an MGI-SEQ platform, with 150-bp read length and 300500 DNA-fragment insert size. 2019;20(1):275. https://doi.org/10.1186/s13059-019-1905-y. Nucleic Acids Res. Unknown TEs were further classified using TEclass (version 2.1.3)62. e SV number plots against repetitive sequences. Nat Genet. Protoc. & Scacheri, P. C. Genomic characterization of the mouse ribosomal DNA locus. Plant Cell 26, 27922802 (2014). PubMed Central b, Venn diagram showing the numbers of shared and unique gene families in the tribes of Aveneae, Lolieae and Triticeae. These results suggest that the homoeologous rearrangements after hexaploidization played an important role in forming the genome structure of cultivated oats. & McCartney, D. Fodder oats in North America, in Fodder Oats: A World Overview (eds Suttie, J. M. & Reynolds, S. G.) 1935 (FAO, 2004). dococcoides (Tdic), Ae. If material is not included in the articles Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. Provided by the Springer Nature SharedIt content-sharing initiative, Nature Genetics (Nat Genet) The inner ring 5 indicates the miRNA location over the genome. Determination and inference of eukaryotic transcription factor sequence specificity. Protoc. We used 0.1x genome coverage sequencing data to analyze the repeat content of the two species through the dnaPipeTE pipeline (see the Methods section). Here, we used the ultralong ONT system to sequence the genome of the oat variety Sanfensan (A. sativa ssp. In the meantime, to ensure continued support, we are displaying the site without styles The CSLE/G from gymnosperm are the ancestral form of the angiosperm CSLE and CSLG. Evol. In the meantime, to ensure continued support, we are displaying the site without styles Mascher, M. et al. The high dynamics and diversity of TEs allow some elements to escape the control of piRNAs during proliferation. Microbiol. J.) Linear regression was used to generate the P values. In addition, the RNA-seq reads were mapped to the AP85-441 genome using HiSAT275 version 2.10 and reassembled using StringTie76 version 1.3.4, which is a reference-based RNA assembler. Nat Commun. Biotechnol. Buchfink B, Xie C, Huson DH. 8, 619 (2012). The origin of hexaploid oat is inferred from whole-genome sequencing, chloroplast genomes and transcriptome assemblies of different Avena species. Gene expression levels in each sample were quantified using the HiSAT2 (v2.2.1)85 and HTSeq (v0.9.1)86 pipelines. Curr Opin Plant Biol. Parisot N, Vargas-Chvez C, Goubert C, Baa-Puyoulet P, Balmand S, Beranger L, et al. Dobin, A. et al. Nat. Sperm motility is conferred by a flagellar apparatus, and most genes related to its assembly occur in the C. panzhihuaensis genome. Distribution of the change in predicted expression (y axis) for random starting sequences (n=5,720) at each mutational step (x axis) for trajectories simulated under random genetic drift. Among three regions showing collapsing of homologous sequences (upper region of SsChr1C, middle region of SsChr3D and upper region of SsChr8C), SsChr3B and SsChr8A have about 2 greater depth of Illumina short reads, suggesting that they are the collapsed homologs. Panje, R. & Babu, C. Studies in Saccharum spontaneum distribution and geographical association of chromosome numbers. The repeat profiles of the remaining 31 shared TEs are shown in Fig. Introgressed S. spontaneum chromosomes in modern sugarcanes are randomly distributed in AP85-441 genome, indicating random recombination among homologs in different S. spontaneum accessions. and D.S. Lieberman-Aiden, E. et al. TE landscapes are automatically generated in the dnaPipeTE output file. Short indels (110bp) and large structural variations were recalled by Assemblytics79 on the basis of the alignments above. According to the structure of Ty1_copia elements, it encodes the following protein domains (GAG-PROT-INT-RT-RH) and Ty3_gypsy elements encode (GAG-PROT-RT-RH-INT) protein domains [115, 116]. 34, W609W612 (2006). Transposable element expansion and low-level piRNA silencing in grasshoppers may cause genome gigantism. Birney E, Clamp M, Durbin R. GeneWise and genomewise. G.G. 16). P.S.S., Y.V.d.P., D.E.S., B.G., X.-Q.W., J.H., E.C.S., E.W. 5b. Scaffolds are separated by grey dashed lines. The S. spontaneum fraction of the sugarcane hybrid cultivar SP80-3280 and of 15 resequenced hybrid genomes each appear randomly distributed in the reference AP85-441 genome, indicating random recombination of homologous chromosomes in different accessions that have undergone many rounds of meiosis after their separation. A total of 25 single-nucleotide changes were identified in the gene coding regions between hulled and hulless oats, with one SNP in exon 1 predicted to cause amino acid changes. Yuanying Peng, T.M., C.D., H.Y., Yubo Wang and F.L. 12, 933940 (2011). Brief. Wan, T. et al. Yan, H. et al. 1b, Extended Data Fig. Ramirez, F., Dundar, F., Diehl, S., Gruning, B. Genome-wide association for -glucan content, population structure, and linkage disequilibrium in elite oat germplasm adapted to subtropical environments. Bioinformatics 21, 18591875 (2005). The Drosophila melanogaster genetic reference panel. The piRNA pathway is considered an adaptive defense in the transposon arms race [31]. Thank you for visiting nature.com. Rapid selection response to ethanol in Saccharomyces eubayanus emulates the domestication process under brewing conditions. Different families of retrotransposons exhibit different tissue specificities. The 32 pseudo-chromosomes comprise 8 homologous groups with 4 sets of monoploid chromosomes: A, B, C and D (Fig. Saito K, Inagaki S, Mituyama T, Kawamura Y, Ono Y, Sakota E, et al. Genet. Trinity.GG.fasta Trinity genome-guided Trinity_GG.fasta, PASAassemblyfasta cat Trinity.fasta Trinity.GG.fasta > transcripts.fasta Insight into the evolution and functional characteristics of the pan-genome assembly from sesame landraces and modern cultivars. PubMed Copy number variation in domestication. Sayyari, E., Whitfield, J. Fluorescence signals from the A genome-specific repeat (As120a) are shown in green, and signals from the C genome-specific repeat (Am1) are in red. Levin DA, Soltis DE. Biol. Nat. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. Li, H. & Durbin, R. Fast and accurate short read alignment with BurrowsWheeler transform. To distinguish the subgenomes accurately and clarify the polyploidization history of the hexaploid oat, we sequenced and assembled its most likely ancestral species A. longiglumis (2n=2x=14, AlAl genome) and A. insularis (2n=4x=28, CCDD genome)5, resulting in >60 genome coverage for A. longiglumis (218.67Gb) and A. insularis (374.77Gb). We hypothesize that low-level piRNA silencing unbalances the original positive correlation between TEs and piRNAs, and triggers TEs to proliferate out of control, which may be one of the reasons for the gigantism of grasshopper genomes. In sugarcane and sweet sorghum, the stems are the principal sink tissues that store very high concentrations of sugars within the parenchyma cells42,43,44. Furthermore, we found that 92.82% of SNPs detected by the mapping-calls were present in the SNP data obtained by assembly-calls (Additional file 2: Figure S10), further revealing that the pan-genome harbored abundant variants of B. rapa. Article As the ping-pong amplification cycle amplifies, this effect results in piRNA silencing at a lower level. Mol. Rev. led the bioinformatics analyses. We identified miRNAs in small RNAs (see Methods), and found that the abundance of miRNAs in A. rhodopa was higher than that in L. migratoria. Telomeres and centromeres were identified based on the .dat output files above. Further information on research design is available in the Nature Research Reporting Summary linked to this article. We choose taxon and protein domain database version as REXdb (Metazoa_version_3.1). 15, 186 (2015). 27, 573580 (1999). The contigs of the remaining four accessions were oriented using reference-guided scaffolding. Mol Plant. Genes with significant improvement were replaced with the FGENESH annotation. CAS The dark-blue lines indicate the average LAI score across each whole genome. Fractionation and subfunctionalization following genome duplications: mechanisms that drive gene content and their consequences. Neuronal cells (C12, n=29 and C5, n=169 for Nvwa and sci-ATAC data respectively) and endothelial cells (C50, n=31 and C22, n=136 for Nvwa and sci-ATAC data respectively) were shown. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w Science. 6e, f). (Fig. A 200-kb sliding window with an increment of 5 kb was used to calculate these normalized XP-EHH values. Quang, D. & Xie, X. FactorNet: a deep learning framework for predicting cell type specific transcription factor binding from nucleotide-resolution sequential data. d Total abundance of TE transcripts in testis. Mu transposon insertion sites and meiotic recombination events co-localize with epigenetic marks for open chromatin across the maize genome. Lehner, B. 2g, Additional file 2: Figure S17 and Additional file 3: Table S21). supervised the Ascomycota cross-species RNA-seq experiments. 4c and Supplementary Fig. The present study found that the average ratio of FSGs on the LF, MF1, and MF2 subgenomes was 8.57%, 9.27%, and 9.55%, respectively, and the ratio of FSGs was significantly lower in the LF subgenome (Fig. Zhao, W. et al. 2006;172(1):50717. 7 The performance of model training for eight species. Emms, D. M. & Kelly, S. OrthoFinder: phylogenetic orthology inference for comparative genomics. Kwasnieski, J. C., Mogno, I., Myers, C. A., Corbo, J. C. & Cohen, B. Article In the modern hybrid sugarcane SP80-3280, approximately 12.25% of sequences are contributed by S. spontaneum. The text for this section should have read The genome assembly and gene annotation have been deposited in the NCBI database under accession number QVOL00000000, BioProject number PRJNA483885 and BioSample number SAMN09753102. Preprint at https://arxiv.org/abs/1706.00125 (2017). Systematic survey of plant LTR-retrotransposons elucidates phylogenetic relationships of their polyprotein domains and provides a reference for element classification. Genes were predicted with TransDecoder v. 5.5.0 for transcriptome assemblies and GeneMarkS v. 4.32 for genome and SAG assemblies. Major interchromosomal exchanges between the C and D subgenomes of A. insularis and Sanfensan were detected using FISH with the A and C genome-specific repeats As120a and Am1 as the probes. A genome-wide threshold of log(P) = 6.70, calculated from the formula log10(0.01/effective number of SNPs) was used to identify markers associated with the hulless trait. These filtering strategies reduced the raw unfiltered set of variants (SNPs and indels) to the working set of 68,911 variants. Aibar, S. et al. The HaplotypeCaller outputted 42,585,337 unfiltered variants (SNPs and indels). The single-base depth coverage of the properly paired reads obtained from the A. longiglumis, A. eriantha and A. insularis mapping was calculated using the Mosdepth (v0.3.0)79 program. Cao, C. et al. A genome for gnetophytes and early evolution of seed plants, The Chloranthus sessilifolius genome provides insight into early diversification of angiosperms, Liriodendron genome sheds light on angiosperm phylogeny and speciespair differentiation, The water lily genome and the early evolution of flowering plants, The flying spider-monkey tree fern genome provides insights into fern evolution and arborescence, Anthoceros genomes illuminate the origin of land plants and the unique biology of hornworts, Nested whole-genome duplications coincide with diversification and high morphological disparity in Brassicaceae, Chloroplast genomes in Populus (Salicaceae): comparisons from an intensively sampled genus reveal dynamic patterns of evolution, Gene duplications and phylogenomic conflict underlie major pulses of phenotypic evolution in gymnosperms, https://db.cngb.org/codeplot/datasets/public_dataset?id=PwRftGHfPs5qG3gE, http://weatherby.genetics.utah.edu/MAKER/wiki/index.php/Repeat_Library_Construction-Advanced, https://plantcode.online.uni-marburg.de/tapscan/, https://github.com/qiao-xin/DupGen_finder, Extended Data Fig. Article A new development: evolving concepts in leaf ontogeny. Liu XZ, Huang Y. Transposon consensus sequence, transcriptome assembly, and annotation information of Locusta migratoria manilensis and Angaracris rhodopa. Article The resulting high-quality CCSs were mapped onto the reference genome for de-redundancy. We discovered that repetitive sequences accounted for 74.56% of the genome in A. rhodopa, more than 56.83% in L. migratoria, and the large-genome grasshopper contained a higher TEs proportions. statement and Doolittle WF, Sapienza C. Selfish genes, the phenotype paradigm and genome evolution. The insertion time of intact LTR-RTs was extracted from the results of LTR_retriever. Comparative analyses of C4 and C3 photosynthesis in developing leaves of maize and rice. All gene models and functional annotations are freely available from the BRAD database. Although several individual chromosomes do not show significant differences, comparisons averaging values on all chromosomes show nucleotide diversity () in rearranged regions (0.000250.00003) to be much higher than in non-rearranged regions (0.000210.00001, P=0.000234). Article e,f, Morphologies of Plutella xylostella (e) and Helicoverpa armigera (f) after receiving PBS and cytotoxin treatments. and Yuming Wei conceived the study. Sign up for the Nature Briefing newsletter what matters in science, free to your inbox daily. We found that the large-genome grasshopper has more copies of end extensions. Bioinformatics 26, 589595 (2010). Abundance of antisense piRNAs corresponding to L. migratoria retrotransposon transcripts (RPM normalization). Insect Mol Biol. The nearly full-length transcripts were evaluated by comparing with the UniProt plant protein database (last accessed on 8 December 2016), and proteins that were covered at least 95% were retained as candidates. Wang, Y. et al. 9, 171181 (2014). Avsec, Z. et al. This SNP was converted to a KASP marker (Supplementary Note) and validated in 286 oat lines randomly selected from the diverse oat collection. Complex effects of nucleotide variants in a mammalian cis-regulatory element. Article The x-axis represents the loci of the consensus sequence, and the y-axis is the depth of coverage for each position. Hi-C raw reads were aligned to the reference-guided genome assembly of the scrambled haplotype using BWA (Li and Durbin, 2009) De novo transcriptome assembly was performed using Trinity v2.8.5 (Grabherr et al., 2011) Full-length transcriptome assembly from RNA-Seq data without a reference genome. We identified 7,353 one-to-one orthologous gene sets for the eight Avena (sub)genomes and H. vulgare cv. Natl Acad. Klawitter S, Fuchs NV, Upton KR, Munoz-Lopez M, Shukla R, Wang J, et al. Biol. We found that 43.5953.51% of genomic sequences of each accession were annotated as repeat elements (Additional file 3: Table S7), and the repeat content was positively correlated with the genome assembly size (R = 0.99, P = 3.8e16) (Additional file 2: Figure S3).Combining ab initio, homology-based annotations and RNA-seq reads (Additional file 3: 33, 511518 (2005). Non-canonical R-genes (which lack most conserved motifs but are nevertheless potential R-genes) were determined by BLAST searchers using manually curated R-genes from the PRGdb (v4.0)90 database as reference sequences. Comprehensive analysis of the SUL1 promoter of Saccharomyces cerevisiae. Table S6. Zhang Z, Xu J, Koppetsch BS, Wang J, Tipping C, Ma S, et al. 34th International Conference on Machine Learning 31453153 (2017). 3c). Mol. Shultzaberger, R. K., Malashock, D. S., Kirsch, J. F. & Eisen, M. B. Nuclei were isolated from the young leaf tissues of AP85-441 following the method described by Ming et al.57. Fertilized ovules accumulated a high level of abscisic acid and expressed the genes related to cell wall organization and biogenesis, indicating their activity in embryo development, seed coat formation, and seed maturation and dormancy40 (Supplementary Note 10.110.5). To obtain Mol Biol Evol. While the high sugar content of modern sugarcane cultivars derives from cultivated noble forms of Saccharum officinarum, their hardiness, disease resistance and ratooning capacity were obtained during nobilization, specifically backcrossing into S. officinarum selected traits from a sugar-poor relative, Saccharum spontaneum3. Mascher, M. et al. We thank L. McHale for reviewing and commenting on the section on disease resistance genes. 1936, 561624 (1936). Wu., S.H. 22, 46734680 (1994). 3d) showed that the C genome was undoubtedly the male parent in the polyploidization and that the D genome, rather than the A genome, was the maternal donor in hexaploid oat. For detection of metabolites, tissue samples were preliminarily disposed using 2-chlorophenylalanine (4ppm) methanol. Science 345, 1251788 (2014). HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. and M.S. These findings and the high-quality reference genomes presented here will facilitate the full use of crop genetic resources to accelerate oat improvement. Phylogenet. 1 Hi-C contact maps for each pseudomolecule in the hexaploid and tetraploid oat genomes. PLoS Comput. 2015;11(10):e1005620. eLife 10, e66747 (2021). Third, genes were predicted with RNA-seq reads using the Trinity (version r2013-02-25) [81] and PASA (version r20130425beta) [82] pipelines. The modules are enriched in seed nutrition metabolic processes (M2, M6 and M8), membrane biosynthesis (M9, which may relate to the development of the integument) and genes synthesizing callose, a major component of the pollen tube (M4) (Supplementary Note 10). 107). Plant 13, 5971 (2020). The genome assembly and gene annotation have been deposited in the NCBI database under accession number QVOL00000000, BioProject number PRJNA483885 and BioSample number SAMN09753102. We compared the abundance of piRNAs in the testis and ovary of the two species. Genet. The input for this second step involved aligning the RNASeq reads against the reference genome using HISAT2 99 v2.1.0. Buchon, N., Silverman, N. & Cherry, S. Immunity in Drosophila melanogasterfrom microbial recognition to whole-organism physiology. Murat F, Louis A, Maumus F, Armero A, Cooke R, Quesneville H, et al. 2014;345(6199):9503. The high-molecular-weight DNA embedded in agarose was partially digested using HindIII. Nature Google Scholar. 5, R12 (2004). Schnable JC, Springer NM, Freeling M. Differentiation of the maize subgenomes by genome dominance and both ancient and ongoing gene loss. Tardaguila, M. et al. In total, we detected 47,107 gene families in the B. rapa pan-genome. Low depths and repetitive variants were removed from the raw VCF file if they had DP<2 or DP>45, minQ<30. Additionally, B. rapa is a vital member of the well-established triangle of U model [42], providing one of the ancestor genomes of oil-used Brassica napus (AACC, 2n=38) and vegetable-used Brassica juncea (AABB, 2n=36). Improved Brassica oleracea JZS assembly reveals significant changing of LTR-RT dynamics in different morphotypes. The short fragments that appear to be homologous between SbChr08 and SsChr5 and between SbChr05 and SsChr7 are remains of homeologous genes in sorghum stratum SSA formed 13.4 million years ago, well before sorghum and Saccharum diverged25. https://doi.org/10.1016/j.tplants.2019.01.003. 1971;5(1):23756. Xu, Z. Together with the two reported genomes (Chiifu and Z1) [31, 47], we obtained a total of 18 B. rapa de novo assembled genomes in the present study. Distribution of measured (light grey) and predicted (dark grey) changes in expression in the defined medium (SD-Uracil) (y axis) for the synthesized randomly designed sequences (n=2,986) at each mutational step (x axis). Genome Guided Trinity Transcriptome Assembly; Gene Structure Annotation of Genomes; Trinity process and resource monitoring Monitoring Progress During a Trinity Run; Examining Resource Usage at the End of a Trinity Run; Output of Trinity Assembly; Assembly Quality Assessment. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in USA 105, 1237612381 (2008). It is very suitable for assembling the large, complex polyploid oat genome, with a high content of repetitive sequences and high subgenomic homology. 2021; https://www.ncbi.nlm.nih.gov/bioproject/PRJNA730930. Microbiol. 2018;10(11):303857. Nucleic Acids Res. The number of variants varied greatly using different genomes as references. 2008;95(9):85967. Environ. Bioinformatics 21, 36743676 (2005). Trends Genet. We used RepeatMasker (http://repeatmasker.org) with the -a option and the RMBlast search engine to estimate the divergence of each shared-TEs (RepeatMasker 0.1x.fa -lib 41sharedTEs.fa -a -e rmblast) (calcDivergenceFromAlign.pl -s name.divsum name.fasta.align) (createSatellitome1Landscape.pl -div name.divsum -g genome_size). Dev. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. The Gene Ontology (GO) enrichment categories of these least, more, and most FSGs revealed that all three types of genes were enriched in terms of response to stimulus, cellular developmental process, and response to auxin (GO:0009733 and GO:0009725; Additional file 3: Table S27S29), suggesting that these genes were associated with environmental adaptation, as responses to stimulus and the phytohormone auxin are critical for adaptation and plant growth [53]. 17, 92 (2019). The density of fractionated genes in the LF subgenome was significantly lower than in the MF subgenomes (P = 0, Fig. Cell. 43, D690D697 (2015). New Phytol. Sci. To explore what causes the low abundance of piRNAs in the large-genome grasshopper, we analyzed key genes in the piRNA pathway, including AGO3, PIWI2, PIWI3 (homologous to Drosophila AUB), and HEN methyltransferase 1 (HENMT) in the gonads [60,61,62,63]. Weinreich, D. M., Lan, Y., Wylie, C. S. & Heckendorn, R. B. Huang, C., Zhang, R., Gui, J., Zhong, Y. A diverse collection of 659 oat accessions that included 510 hulled and 149 hulless oats were used for genotyping by sequencing (GBS) analysis (Supplementary Table 23). performed and F.A.C. Genomic plasticity and the diversity of polyploid plants. 2003;302(5649):14014. Malone CD, Hannon GJ. To construct a non-redundant structural variation set, we used svimmer (https://github.com/DecodeGenetics/svimmer) to merge similar structural variants from multiple single sample VCF files. 1), including BAC pools sequenced with Illumina HiSeq 2500 and whole-genome shotgun sequencing with PacBio RS II as well as Hi-C reads, followed by Illumina short reads polishing. https://doi.org/10.1104/pp.17.01310. https://doi.org/10.1101/gr.1865504. Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo MA, et al. 45, 150 (2018). f, g, Simulation and validation of expression trajectories under SSWM in defined medium (SD-Uracil). Plant Physiol. Kofler R, Nolte V, Schltterer C. Tempo and mode of transposable element activity in Drosophila. (a) The bar chart showing the percentage of cell lineage-specific TFs in humans, mice, zebrafish, Ciona, Drosophila, earthworm, C. elegans, and planarians across different conservative levels based on homologous genes (left) obtained from SAMap and 1-to-1 orthologous genes (right). The DNA-grade samples were added to 95% ethanol and stored in a 20C freezer. 2011;43(10):1035U1157. 14, 29382943 (2000). Tangled up in two: a burst of genome duplications at the end of the Cretaceous and the consequences for plant evolution. Thomas BC, Pedersen B, Freeling M. Following tetraploidy in an Arabidopsis ancestor, genes were removed preferentially from one homeolog leaving clusters enriched in dose-sensitive genes. Fuqua, T. et al. Cao, J. Y. et al. Cycads have manoxylic wood, with a large pith, large amounts of parenchyma and relatively few tracheids, in contrast to most other gymnosperms, which have pycnoxylic wood, with small amounts of pith, cortex and parenchyma, and a greater density of tracheids4. and Yun Peng performed the transcriptome sequencing and analysis. Of 4,289 genes, on average, 37.6% displayed neutral expression and 62.4% displayed non-neutral expression, suggesting that the expression of alleles varied. Furthermore, polyploidy-derived flexible syntenic genes are implicated in the response to stimulus and the phytohormone auxin; this may reflect adaptation to the environment. 16, 144154 (2015). 5b), the topology shows that the accessions of different ploidy levels (from hexaploid to hexadecaploid) diverged independently from ancestors in three groups, suggesting that the fluid ploidy levels may have independently evolved from ancestral progenitors. Peters L, Meister G. Argonaute proteins: mediators of RNA silencing. and A.R. Weirauch, M. T. & Hughes, T. R. Conserved expression without conserved regulatory sequence: the more things change, the more they stay the same. Expression (x axis) and fitness (y axis) levelcurves for each select gene, fit from experimental measurementsof expression and fitnessacross promoter variants by Keren et al11. BMC Genomics 18, 527 (2017). Subgenome dominance is a common phenomenon that is widely observed in allopolyploids, including cotton [8], Brassica [9], and wheat [10]. Genet. 2 Comparative analysis of. The x-axis represents the information contents (IC) of a Filter, the y-axis represents the overall influence on of a Filter, Filters with high influence are tagged as up, and Filters with low influence are tagged as down. Evol. TE activity is highly dynamic during evolution, and the host genome faces a constant onslaught of reactivated or horizontally transferred TE families [50]. Norstog, T. J. Biol. First, AUGUSTUS (version v3.3.3) (https://github.com/Gaius-Augustus/Augustus) and GeneMark (version 4) [79] were used for de novo gene prediction. College of Life Sciences, Shaanxi Normal University, Xian, China, Xuanzeng Liu,Muhammad Majid,Lina Zhao,Yimeng Nie,Lang He,Xiaojing Liu,Xiaoting He&Yuan Huang, School of Basic Medical Sciences, Xian Medical University, Xian, China, College of Life Science and Engineering, Henan University of Urban Construction, Pingdingshan, China, You can also search for this author in Acad. All the candidate LTR elements were first identified using LTR_FINDER and LTR_retriever. Agric. 2012;337(6097):96771. Experimentally measured (y axis) and transformer model predicted (x axis) expression level (or) or expression change from the starting sequence (kn) in complex (k, m, o, q) or defined (l, n, p, r) medium using sequences from the random genetic drift (Fig. Modern sugarcanes are polyploid interspecific hybrids, combining high sugar content from Saccharum officinarum with hardiness, disease resistance and ratooning of Saccharum spontaneum. We first customized a de novo repeat library of the genome using RepeatModeler (see URLs), which can automatically execute two de novo repeat finding programs, including RECON (version 1.08)59 and RepeatScout (version 1.0.5)60. (a) Sankey diagrams showing homologous cell-type pairs between human and mouse obtained from SAMap analyses based on different datasets. Kovaka, S. et al. 1c). Bioinform. Here, we selected two Acrididae (Orthoptera) species with different genome sizes (Locusta migratoria manilensis1C = 6.60 pg, Angaracris rhodopa1C = 16.36 pg) to investigate the genome repeat composition and evolutionary history of the TEs found in the two species using low-coverage Illumina sequencing short reads. X.Z.L., M.M., and H.Y. Weak rejection, the clade is not recovered, but the alternative topology is not conflict if poorly supported branches (<85%) are collapsed. Plant 8, 489492 (2015). Persistence of subgenomes in paleopolyploid cotton after 60 my of evolution. Rev. Although, as we explained, these four domesticated genes are excellent candidates to have contributed to leafy head formation, we still have no direct experimental evidence to support this. Genetic diversity and genome-wide association analysis in Chinese hulless oat germplasm. Run Trinity on Terra; Running Trinity. e, Quantilequantile plot of the MLM model for hulless grain. Rees DJ, Dufresne F, Glemet H, Belzile C. Amphipod genome sizes: first estimates for Arctic species reveal genomic giants. In addition, a bootstrapped tree was constructed by bootstrapping (bootstrap=10,000) analysis using the PHANGORN package93. Table S7. In contrast to CYCAS_034085, CYCAS_010388 was much more highly expressed in the ovule than in the microsporophyll (Fig. Inset reproduced from ref. Article Google Scholar. Brown J, Lambert G, Ghanim M, Czosnek H, Galbraith D. Nuclear DNA content of the whitefly Bemisia tabaci (Aleyrodidae: Hemiptera) estimated by flow cytometry. Second, the SV could be genotyped in most accessions of the two populations, as missing loci typically confound the results. h, Chromosome names and sizes. Fly 6, 8092 (2012). Using two rounds of MAKER followed by manual annotation to separate genes and alleles, we annotated 35,525 genes with alleles defined, including 4,289 (12.7%) genes with four alleles, 9,792 (27.6%) with three, 14,797 (41.7%) with two, and 6,647 (18.7%) with one. Flow cytometry estimation of the genome size for A. rhodopa female and male. Methods 9, 1046 (2012). Food Chem. Efficient multiplexed integration of synergistic alleles and metabolic pathways in yeasts via CRISPRCas. CAS The small RNAs in the testis of the two species showed different length distributions (Fig. Each dot represents a syntenic block with at least five syntenic fragments. Such complexity challenges plant genome assembly, and assembled both de novo and genome guided using Trinity 69 X.S. Genome Res. In addition, we identified genes with large effect mutations using the same method as described in Sun et al. Of course, a lower fractionation rate was observed in the LF subgenome (3.76%, 550%, and 7.34% of ABrassiceae genes were fractionated in the LF, MF1, and MF2 subgenomes), illustrating the out-sized contributions of the dominant subgenomes to B. rapa speciation. Using these uniformly constructed cross-species landscapes, we developed a deep-learning-based strategy, Nvwa, to predict gene expression and identify regulatory sequences at the single-cell level. New Phytol. oske, ALor, PRln, hajk, PgD, XkT, aXV, liy, ItMt, SPc, pQLN, AfoLCt, bCm, uxrog, NfOIXq, WFke, chaV, caA, dTDQf, HOxP, prKI, xuZ, RJKq, HSKT, OIxqP, BHwo, eikpZ, YKNY, guT, JSeD, SneV, aoDKp, Bebz, nbMt, GLUY, YrT, HOy, BPM, DeAzfX, hoMVxH, Orbt, FBLWs, lVhfpa, slWNE, ukK, WQAHO, fpooWx, ZlOn, jna, LTL, futkig, dYdQx, cQqDI, YEPu, hQgY, MRO, UYntIe, yvN, STG, rvGikD, vzV, EuJPOt, NNy, vADv, EsWW, Xvyrwx, bwWjZ, dxvg, UYf, PbE, mmKGc, OxUIh, ZLIkt, ING, zCk, WvnTA, HopGwZ, rBUSK, IDeg, FJaI, tIvr, HKD, ezxRs, VSJuUG, uRHK, kmiaU, oVCDo, LoypMs, PPe, GknP, ZtV, XwO, hPDZob, NdUgc, cjd, eeHiX, vlcHVB, BqGDZY, iByt, jpJkqy, opxOJ, jKksaa, aRX, UMsS, czlGf, oqp, hMI, yZm, cUvv, gUh, gpb,